Acute DiseaseNCT03982589
Telomere Length in Relation to Acute Stress Response in Critical Care Patients
An observational study of Acute Disease and Telomere Shortening, run by Rabin Medical Center at 1 site in Israel.
Trial summary
the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length. Read more about this study
- Who is it for?
- Ages 18 to 75 years
- Conditions the study is for
- Acute Disease, Telomere Shortening
- How many people
- 40 participants
- Where
- 1 siteIsrael
- Study dates
- 1 Oct 2017to 30 Sep 2018
- How long will I take part?
- 6 Months
- Phase
- Observational
- Are there results?
- None posted in the registry
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 75 years
- All sexes
- No healthy volunteers
- Adult, Older adult
Study population: adults (male and females) admitted to the ICU
Who may be able to join
- • Patients hospitalized up to 72 hours prior to admission to the ICU
- Predicted ICU stay is at least 5 days
Who cannot join
- • Pregnancy and lactation
Trial locations and contacts
1 site in 1 country.
About this study
the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length.
Read the detailed description
Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge day. The blood sample processing was as follows: 5 ml of blood was collected and the red blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop device (Thermo Fisher, USA).
DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20] with slight modifications. Each DNA sample was analyzed by two sets of primers detailed below, one for telomere length analysis and one for a reference gene analysis (human hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:
telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG
Reaction PCR were processed as follows:
50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were performed using the Step One device (ABI, USA).
- Conditions
- Acute Disease, Telomere Shortening
- Medical subject headings
- Acute Disease
What is being measured
The primary outcome is the main question the study is designed to answer.
telomere length difference
the difference between telomere length in percent between samples taken
Measured: 7 days
Secondary outcomes (2)
correlation between mortality and telomere length
correlation between mortality and telomere length
Measured: 6 month
correlation between telomere length change and leukocytes count change
correlation between telomere length change and leukocytes count change
Measured: 7 days
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted11 Jun 2019
- Study start1 Oct 2017
- Primary completion30 Mar 2018
- Study completion30 Sep 2018
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Other trials for Acute DiseaseStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Cohort
- Time perspective
- Prospective
- Enrolment
- 40 participants (actual)
- Target duration
- 6 Months
Sponsor and investigators
- Lead sponsor
- Rabin Medical Center
- Sponsor type
- University, hospital or other
- Responsible party
- Sponsor
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT03982589
- Sponsor's protocol ID
- 0319-11-RMC
- Status last verified
- Jun 2019
- First submitted
- 10 Jun 2019
- Last updated
- 25 Jun 2019
- Results posted
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
Study at a glance
From the registry record, last updated by the sponsor on 25 Jun 2019. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Telomere Length in Relation to Acute Stress Response in Critical Care Patients
- ClinicalTrials.gov ID
- NCT03982589
- Acronym / sponsor ID
- 0319-11-RMC
- Conditions
- Acute Disease, Telomere Shortening
- Study type
- Observational
- Recruitment status
- Completed
- Enrolment
- 40 participants (actual)
- Lead sponsor
- Rabin Medical CenterUniversity, hospital or other
- Study start
- 1 Oct 2017 (actual)
- Primary completion
- 30 Mar 2018 (actual)
- Study completion
- 30 Sep 2018 (actual)
- First posted
- 11 Jun 2019 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length.
Detailed description
Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge day. The blood sample processing was as follows: 5 ml of blood was collected and the red blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop device (Thermo Fisher, USA).
DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20] with slight modifications. Each DNA sample was analyzed by two sets of primers detailed below, one for telomere length analysis and one for a reference gene analysis (human hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:
telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG
Reaction PCR were processed as follows:
50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were performed using the Step One device (ABI, USA).
Study design
- Observational model
- Cohort
- Time perspective
- Prospective
- Target follow-up
- 6 Months
Who may qualify
- Ages
- 18 to 75 years
- Sex
- All
- Healthy volunteers
- Not accepted
- Age groups
- Adult, Older adult
- Study population
- adults (male and females) admitted to the ICU
Key inclusion criteria (2 listed)
- • Patients hospitalized up to 72 hours prior to admission to the ICU
Key exclusion criteria (1 listed)
- • Pregnancy and lactation
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Primary outcome
telomere length difference
Time frame: 7 days
the difference between telomere length in percent between samples taken
2 secondary outcomes
correlation between mortality and telomere length
Time frame: 6 month
correlation between telomere length change and leukocytes count change
Time frame: 7 days
Results and safety
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 25 Jun 2019.
Related trials for Acute Disease
RecruitingObservational study
Population Pharmacokinetics of Temocillin in Acute Enterobacterial Pyelonephritis in Children
Pyelonephritis
Not yet recruiting
Temporal Interference Stimulation for Upper-Limb Motor Recovery in Early Subacute Stroke
Acute Ischemic Stroke
Not yet recruitingPhase 1
Phase I Open-Label Safety Trial of Pembrolizumab for Neurological Post- Acute Sequelae of SARS-CoV-2 (PD1-PASC I)
Post-Acute COVID-19 Syndrome
RecruitingPhase 4
The Effects of Ferric Derisomaltose in Patients With Acute Heart Failure and Iron Deficiency on Exercise Capacity and Quality of Life(COREVIVE-HFrEF)
Heart Failure With Reduced Ejection Fraction, Iron Deficiency
Enrolling by invitation
Personalized Ventilator Settings for Patients on ECMO
Acute Respiratory Distress Syndrome (ARDS), Extracorporeal Membrane Oxygenation
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
The record lists no contact. Use the official record to reach the sponsor.
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
An observational study of Acute Disease and Telomere Shortening, run by Rabin Medical Center at 1 site in Israel.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 2 inclusion and 1 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: finished, as of the sponsor's last update on 25 Jun 2019. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in Israel. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
How can a doctor refer a patient or contact the research team?
The record lists no contact. The official record names the sponsor, who can be asked directly. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
telomere length difference (time frame: 7 days). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 25 Jun 2019.