Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK ExpressionNCT04667988
JAK2 Mutation May Predict Response and Guide First Line Treatment in Rheumatoid Arthritis
A study testing JAK expression in people with Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression, run by Mansoura University at 1 site in Egypt.
Trial summary
This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Read more about this study
- Who is it for?
- Ages 18 to 80 yearsHealthy volunteers can take part
- Conditions the study is for
- Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression
- What is being tested?
- JAK expression
- Could I receive a placebo?
- No, everyone receives an active treatment
- How many people
- 76 participants
- Where
- 1 siteEgypt
- Study dates
- 1 Jan 2019to 1 May 2020
- Phase
- Interventional
- Are there results?
- None posted in the registry
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 80 years
- All sexes
- Healthy volunteers accepted
- Adult, Older adult
Who may be able to join
- New case RA patients
- good liver and renal function
Who cannot join
- Other autoimmune diss
- Malignancy
- Active viral infection
- pregnancy and lactation
Trial locations and contacts
1 site in 1 country.
About this study
This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.
Read the detailed description
PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker:
The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). Cycling conditions were 35 cycles with annealing temperature 58.5oC flowed by agarose gel 2% electrophoresis for bands detections.
All patients started treatment by conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.
The Disease Activity Score (DAS) and the DAS28 have been developed to measure disease activity in RA both in daily clinical practice as well as in clinical trials on a group as well as individual level. The DAS/DAS28 is a continuous measure of RA disease activity that combines information from swollen joints, tender joints, acute phase response and general health The DAS28 is a measure of disease activity in rheumatoid arthritis (RA). DAS stands for 'disease activity score' and the number 28 refers to the 28 joints that are examined in this assessment. questionnaires (e.g. the HAQ which assesses function), X-rays, and newer imaging techniques such as ultrasound and MRI.
The ACR20 is a composite measure defined as both improvement of 20% in the number of tender and number of swollen joints, and a 20% improvement in three of the following five criteria: patient global assessment, physician global assessment, functional ability measure [most often Health Assessment Questionnaire (HAQ)], visual analog pain scale, and erythrocyte sedimentation rate or C-reactive protein (CRP). ACR50 and ACR70 are the same instruments with improvement levels defined as 50% and 70% respectively versus 20% for ACR20.
- Being tested
- JAK expression
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
JAK expressionDiagnostic test
JAK2 assessment in blood by PCR
| Study group | Role | What they receive |
|---|---|---|
| RA patients | Experimental | newly diagnosed RA will started therapy with conventional synthetic DMARDs (including methotrexate) Receives: Diagnostic Test: JAK expression |
| control | Experimental | JAK2 mutation assesment by PCR Receives: Diagnostic Test: JAK expression |
What is being measured
The primary outcome is the main question the study is designed to answer.
JAK2 mutation expression in newly diagnosed RA patients
Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.
Measured: 6 months
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted16 Dec 2020
- Study start1 Jan 2019
- Primary completion1 Apr 2020
- Study completion1 May 2020
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Other trials for Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK ExpressionStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Interventional
- Phase
- Phase N/A
- Primary purpose
- Other
- Allocation
- Non-randomised
- Intervention model
- Single group
- Masking
- Single blind
- Who is masked
- Investigator
- Enrolment
- 76 participants (actual)
Sponsor and investigators
- Lead sponsor
- Mansoura University
- Sponsor type
- University, hospital or other
- Responsible party
- Sponsor
- Investigators
- Mohamed Elbaiomy, MD, Study chair, Mansoura University Hospital
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT04667988
- Sponsor's protocol ID
- R.20.11.1075
- Status last verified
- Jan 2020
- First submitted
- 9 Dec 2020
- Last updated
- 16 Dec 2020
- Results posted
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No: Asses response of treatment in RA patients in relation to JAK2 mutation
Study at a glance
From the registry record, last updated by the sponsor on 16 Dec 2020. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- JAK2 Mutation May Predict Response and Guide First Line Treatment in Rheumatoid Arthritis
- ClinicalTrials.gov ID
- NCT04667988
- Acronym / sponsor ID
- R.20.11.1075
- Study type
- Interventional
- Recruitment status
- Completed
- Enrolment
- 76 participants (actual)
- Lead sponsor
- Mansoura UniversityUniversity, hospital or other
- Study start
- 1 Jan 2019 (actual)
- Primary completion
- 1 Apr 2020 (actual)
- Study completion
- 1 May 2020 (actual)
- First posted
- 16 Dec 2020 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.
Detailed description
PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker:
The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). Cycling conditions were 35 cycles with annealing temperature 58.5oC flowed by agarose gel 2% electrophoresis for bands detections.
All patients started treatment by conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.
The Disease Activity Score (DAS) and the DAS28 have been developed to measure disease activity in RA both in daily clinical practice as well as in clinical trials on a group as well as individual level. The DAS/DAS28 is a continuous measure of RA disease activity that combines information from swollen joints, tender joints, acute phase response and general health The DAS28 is a measure of disease activity in rheumatoid arthritis (RA). DAS stands for 'disease activity score' and the number 28 refers to the 28 joints that are examined in this assessment. questionnaires (e.g. the HAQ which assesses function), X-rays, and newer imaging techniques such as ultrasound and MRI.
The ACR20 is a composite measure defined as both improvement of 20% in the number of tender and number of swollen joints, and a 20% improvement in three of the following five criteria: patient global assessment, physician global assessment, functional ability measure [most often Health Assessment Questionnaire (HAQ)], visual analog pain scale, and erythrocyte sedimentation rate or C-reactive protein (CRP). ACR50 and ACR70 are the same instruments with improvement levels defined as 50% and 70% respectively versus 20% for ACR20.
Study design
- Primary purpose
- Other
- Allocation
- Non-randomised
- Intervention model
- Single group
- Masking
- Single blind (investigator)
- Number of arms
- 2
| Arm | Type | Receives |
|---|---|---|
| RA patients | Experimental | Diagnostic Test: JAK expressionnewly diagnosed RA will started therapy with conventional synthetic DMARDs (including methotrexate) |
| control | Experimental | Diagnostic Test: JAK expressionJAK2 mutation assesment by PCR |
Who may qualify
- Ages
- 18 to 80 years
- Sex
- All
- Healthy volunteers
- Accepted
- Age groups
- Adult, Older adult
Key inclusion criteria (2 listed)
- New case RA patients
- good liver and renal function
Key exclusion criteria (4 listed)
- Other autoimmune diss
- Malignancy
- Active viral infection
- pregnancy and lactation
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| JAK expressionJAK2 assessment in blood by PCR | Diagnostic test | RA patients, control |
Primary outcome
JAK2 mutation expression in newly diagnosed RA patients
Time frame: 6 months
Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.
Results and safety
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 16 Dec 2020.
- Individual participant dataSharing planned: No. Asses response of treatment in RA patients in relation to JAK2 mutation
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
Mohamed Elbaiomy, MD study chair
Mansoura University Hospital
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
A study testing JAK expression in people with Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression, run by Mansoura University at 1 site in Egypt.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 2 inclusion and 4 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: finished, as of the sponsor's last update on 16 Dec 2020. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in Egypt. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
How can a doctor refer a patient or contact the research team?
The record lists no contact. The official record names the sponsor, who can be asked directly. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
JAK2 mutation expression in newly diagnosed RA patients (time frame: 6 months). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 16 Dec 2020.