ObesityNCT04827628
Effect of Oryza Sativa l Extract to LPS, ZO-1, and Intestinal Microbiota in Obese Individuals
A study testing Oryza Sativa Extract in people with Obesity, run by Hasanuddin University at 1 site in Indonesia.
Trial summary
Background : Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota… Read more about this study
- Who is it for?
- Ages 18 to 21 years, men onlyHealthy volunteers can take part
- Conditions the study is for
- Obesity
- What is being tested?
- Oryza Sativa Extract
- Could I receive a placebo?
- No, everyone receives an active treatment
- How many people
- 42 participants
- Where
- 1 siteIndonesia
- Study dates
- 10 Apr 2021to 1 Jun 2021
- Phase
- Interventional
- Are there results?
- None posted in the registry
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 21 years
- Men only
- Healthy volunteers accepted
- Adult
Who may be able to join
- No consumption of the antioxidant supplement
- No consumption of prebiotic and probiotic
- Currently not undergo specific diet
Who cannot join
- Current smoker
- Diagnosed with chronic diseases
- Patients with altered kidney and liver function
- Unable to participate for any reason
Trial locations and contacts
1 site in 1 country.
Indonesia1 site
Hasanuddin University Medical Research Center / HUMRC
Makassar, South Sulawesi, 90245
Armanto Makmun, M.Kes, +6285299900032, armanto.makmun@umi.ac.id
Rachmat Syamsu, M.Kes, +6285242150099, rachmatfaisal.syamsu@umi.ac.id
About this study
Official title: Effect of Oryza Sativa l Extract to Serum Lipopolysaccharide, Tight Junction Protein 1 (ZO-1), and Intestinal Microbiota Expression Among Obese Individual
Background :
Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters.
Read more
Objective :
To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults.
Method:
A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention
Hypothesis:
Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.
Read the detailed description
Method:
- Non Randomized clinical trial with double-blind
- Participants will be recruited consecutively
- Matching technique will be applied following several variables adjustment
- Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group
Sample size calculation:
The difference between two independent means sample size calculation is applied following the elements below:
- Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14
Intervention :
- Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg.
- Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where : anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9
Control
- Active comparator using citric acid and sorbitol mixture
Biological sample:
- Serum sample preparation : Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C.
- Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below :
- Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC),
- Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)),
- Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA),
- Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA),
- Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA)
Protection of Human subject according to Helsinki Declaration
- Participants are allowed to receive the information of research including purpose, possible intervention, and side effects.
- Possible side effect including :
- Participants are allowed to withdraw from the study for any reason.
Statistical Analysis Plan
- Descriptive statistic of the baseline
- The bivariate analysis between all variables and the outcomes
- Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups
- The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups
- Alternative statistical test: Linear mixed model to adjust the fixed and random effects.
- Conditions
- Obesity
- Being tested
- Oryza Sativa Extract, Control
- Keywords
- Lipopolysaccharide, Zonula Occludens 1, Obesity, Oryza sativa, Anthocyanin, Intestinal Microbiota
- Medical subject headings
- Obesity
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
Oryza Sativa ExtractDietary supplement
The product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal.
ControlDietary supplement
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal
| Study group | Role | What they receive |
|---|---|---|
| Obese with Oryza sativa extract | Experimental | The group with a body mass index of more than 25 kg/m2 that receive the Oryza Sativa Extract Receives: Dietary Supplement: Oryza Sativa Extract |
| Obese with control | Active comparator | The group with a body mass index of more than 25 kg/m2 that receive the citric acid and sorbitol mixture Receives: Dietary Supplement: Control |
| Normal Body Mass Index | Active comparator | The group with a body mass index of less than 25 kg/m2 that receive the citric acid and sorbitol mixture Receives: Dietary Supplement: Control |
What is being measured
The primary outcome is the main question the study is designed to answer.
Lipopolysaccharide (LPS) level of Serum
Measured using Enzyme-Linked Immunosorbent Assay (ELISA)
Measured: Changes of LPS value from baseline to the last day of intervention (three weeks)
Microbiota Level in Stool sample
Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli
Measured: Changes of Microbiota value from baseline to the last day of intervention (three weeks)
Secondary outcomes (1)
Zonula Occludens 1 (ZO1) serum level
Measured using Enzyme-Linked Immunosorbent Assay (ELISA)
Measured: Changes of ZO1 value from baseline to the last day of intervention (three weeks)
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted1 Apr 2021
- Study start10 Apr 2021 (estimated)
- Primary completion1 May 2021 (estimated)
- Study completion1 Jun 2021 (estimated)
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Publications (11)Papers the sponsor has linked to this study.
- Other trials for ObesityStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Interventional
- Phase
- Phase N/A
- Primary purpose
- Treatment
- Allocation
- Non-randomised
- Intervention model
- Parallel groups
- Model description
- a non-randomized trial is implemented involving three arms consists of an obese group as the intervention and two control groups, people with normal Body Mass Index, and Obese.
- Masking
- Triple blind
- Who is masked
- Participant, Care provider, Outcomes assessor
- Enrolment
- 42 participants (estimated)
Sponsor and investigators
- Lead sponsor
- Hasanuddin University
- Sponsor type
- University, hospital or other
- Responsible party
- Principal investigator, Bumi Herman, Hasanuddin University
- Investigators
- Agussalim Bukhari, Ph.D, Principal investigator, Hasanuddin UniversityNurpudji Taslim, Prof., Principal investigator, Hasanuddin UniversityAminuddin Aminuddin, Ph.D, Principal investigator, Hasanuddin UniversityArmanto Makmun, M.Kes, Principal investigator, Universitas Muslim IndonesiaRachmat Syamsu, M.Kes, Principal investigator, Universitas Muslim IndonesiaBumi Herman, MD. Ph.D, Principal investigator, Chulalongkorn University
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT04827628
- Sponsor's protocol ID
- 1803211718
- Status last verified
- Apr 2021
- First submitted
- 30 Mar 2021
- Last updated
- 5 Apr 2021
- Results posted
- No
- Data monitoring committee
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No: Only protocol could be shared for public
Publications
Aguirre M, Venema K. Does the Gut Microbiota Contribute to Obesity? Going beyond the Gut Feeling. Microorganisms. 2015 Apr 27;3(2):213-35. doi: 10.3390/microorganisms3020213.
PubMed 27682087Angelakis E, Armougom F, Million M, Raoult D. The relationship between gut microbiota and weight gain in humans. Future Microbiol. 2012 Jan;7(1):91-109. doi: 10.2217/fmb.11.142.
PubMed 22191449Tehrani AB, Nezami BG, Gewirtz A, Srinivasan S. Obesity and its associated disease: a role for microbiota? Neurogastroenterol Motil. 2012 Apr;24(4):305-11. doi: 10.1111/j.1365-2982.2012.01895.x. Epub 2012 Feb 20.
PubMed 22339979Tan J, Li Y, Hou DX, Wu S. The Effects and Mechanisms of Cyanidin-3-Glucoside and Its Phenolic Metabolites in Maintaining Intestinal Integrity. Antioxidants (Basel). 2019 Oct 12;8(10):479. doi: 10.3390/antiox8100479.
PubMed 31614770Morais CA, de Rosso VV, Estadella D, Pisani LP. Anthocyanins as inflammatory modulators and the role of the gut microbiota. J Nutr Biochem. 2016 Jul;33:1-7. doi: 10.1016/j.jnutbio.2015.11.008. Epub 2015 Nov 26.
PubMed 27260462Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-O-beta-D-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol. 2010 Aug;10(8):959-66. doi: 10.1016/j.intimp.2010.05.009.
PubMed 20669401Lee B, Moon KM, Kim CY. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J Immunol Res. 2018 Dec 16;2018:2645465. doi: 10.1155/2018/2645465. eCollection 2018.
PubMed 30648119Ito VC, Lacerda LG. Black rice (Oryza sativa L.): A review of its historical aspects, chemical composition, nutritional and functional properties, and applications and processing technologies. Food Chem. 2019 Dec 15;301:125304. doi: 10.1016/j.foodchem.2019.125304. Epub 2019 Jul 31.
PubMed 31394335Igwe EO, Charlton KE, Probst YC, Kent K, Netzel ME. A systematic literature review of the effect of anthocyanins on gut microbiota populations. J Hum Nutr Diet. 2019 Feb;32(1):53-62. doi: 10.1111/jhn.12582. Epub 2018 Jul 8.
PubMed 29984532Hersoug LG, Moller P, Loft S. Gut microbiota-derived lipopolysaccharide uptake and trafficking to adipose tissue: implications for inflammation and obesity. Obes Rev. 2016 Apr;17(4):297-312. doi: 10.1111/obr.12370. Epub 2015 Dec 29.
PubMed 26712364Bae IY, An JS, Oh IK, Lee HG. Optimized preparation of anthocyanin-rich extract from black rice and its effects on in vitro digestibility. Food Sci Biotechnol. 2017 Aug 28;26(5):1415-1422. doi: 10.1007/s10068-017-0188-x. eCollection 2017.
PubMed 30263677
Study at a glance
From the registry record, last updated by the sponsor on 5 Apr 2021. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Effect of Oryza Sativa l Extract to Serum Lipopolysaccharide, Tight Junction Protein 1 (ZO-1), and Intestinal Microbiota Expression Among Obese Individual
- ClinicalTrials.gov ID
- NCT04827628
- Acronym / sponsor ID
- 1803211718
- Conditions
- Obesity
- Keywords
- Lipopolysaccharide, Zonula Occludens 1, Obesity, Oryza sativa, Anthocyanin, Intestinal Microbiota
- Study type
- Interventional
- Recruitment status
- Unknown status
- Enrolment
- 42 participants (estimated)
- Lead sponsor
- Hasanuddin UniversityUniversity, hospital or other
- Study start
- 10 Apr 2021 (estimated)
- Primary completion
- 1 May 2021 (estimated)
- Study completion
- 1 Jun 2021 (estimated)
- First posted
- 1 Apr 2021 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Background :
Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters.
Objective :
To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults.
Method:
A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention
Hypothesis:
Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.
Detailed description
Method:
- Non Randomized clinical trial with double-blind
- Participants will be recruited consecutively
- Matching technique will be applied following several variables adjustment
- Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group
Sample size calculation:
The difference between two independent means sample size calculation is applied following the elements below:
- Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14
Intervention :
- Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg.
- Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where : anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9
Control
- Active comparator using citric acid and sorbitol mixture
Biological sample:
- Serum sample preparation : Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C.
- Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below :
- Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC),
- Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)),
- Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA),
- Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA),
- Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA)
Protection of Human subject according to Helsinki Declaration
- Participants are allowed to receive the information of research including purpose, possible intervention, and side effects.
- Possible side effect including :
- Participants are allowed to withdraw from the study for any reason.
Statistical Analysis Plan
- Descriptive statistic of the baseline
- The bivariate analysis between all variables and the outcomes
- Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups
- The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups
- Alternative statistical test: Linear mixed model to adjust the fixed and random effects.
Study design
- Primary purpose
- Treatment
- Allocation
- Non-randomised
- Intervention model
- Parallel groups
- Masking
- Triple blind (participant, care provider, outcomes assessor)
- Number of arms
- 3
- Model description
- a non-randomized trial is implemented involving three arms consists of an obese group as the intervention and two control groups, people with normal Body Mass Index, and Obese.
| Arm | Type | Receives |
|---|---|---|
| Obese with Oryza sativa extract | Experimental | Dietary Supplement: Oryza Sativa ExtractThe group with a body mass index of more than 25 kg/m2 that receive the Oryza Sativa Extract |
| Obese with control | Active comparator | Dietary Supplement: ControlThe group with a body mass index of more than 25 kg/m2 that receive the citric acid and sorbitol mixture |
| Normal Body Mass Index | Active comparator | Dietary Supplement: ControlThe group with a body mass index of less than 25 kg/m2 that receive the citric acid and sorbitol mixture |
Who may qualify
- Ages
- 18 to 21 years
- Sex
- Male only
- Healthy volunteers
- Accepted
- Age groups
- Adult
Key inclusion criteria (3 listed)
- No consumption of the antioxidant supplement
- No consumption of prebiotic and probiotic
- Currently not undergo specific diet
Key exclusion criteria (4 listed)
- Current smoker
- Diagnosed with chronic diseases
- Patients with altered kidney and liver function
- Unable to participate for any reason
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| Oryza Sativa ExtractThe product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal. | Dietary supplement | Obese with Oryza sativa extract |
| Controlcitric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal | Dietary supplement | Normal Body Mass Index, Obese with control |
Primary outcome
Lipopolysaccharide (LPS) level of Serum
Time frame: Changes of LPS value from baseline to the last day of intervention (three weeks)
Measured using Enzyme-Linked Immunosorbent Assay (ELISA)
Microbiota Level in Stool sample
Time frame: Changes of Microbiota value from baseline to the last day of intervention (three weeks)
Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli
1 secondary outcome
Zonula Occludens 1 (ZO1) serum level
Time frame: Changes of ZO1 value from baseline to the last day of intervention (three weeks)
Results and safety
Results are not available in the source record.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 5 Apr 2021.
- Background: PubMed 27682087Aguirre M, Venema K. Does the Gut Microbiota Contribute to Obesity? Going beyond the Gut Feeling. Microorganisms. 2015 Apr 27;3(2):213-35. doi: 10.3390/microorganisms3020213.
- Background: PubMed 22191449Angelakis E, Armougom F, Million M, Raoult D. The relationship between gut microbiota and weight gain in humans. Future Microbiol. 2012 Jan;7(1):91-109. doi: 10.2217/fmb.11.142.
- Background: PubMed 22339979Tehrani AB, Nezami BG, Gewirtz A, Srinivasan S. Obesity and its associated disease: a role for microbiota? Neurogastroenterol Motil. 2012 Apr;24(4):305-11. doi: 10.1111/j.1365-2982.2012.01895.x. Epub 2012 Feb 20.
- Background: PubMed 31614770Tan J, Li Y, Hou DX, Wu S. The Effects and Mechanisms of Cyanidin-3-Glucoside and Its Phenolic Metabolites in Maintaining Intestinal Integrity. Antioxidants (Basel). 2019 Oct 12;8(10):479. doi: 10.3390/antiox8100479.
- Background: PubMed 27260462Morais CA, de Rosso VV, Estadella D, Pisani LP. Anthocyanins as inflammatory modulators and the role of the gut microbiota. J Nutr Biochem. 2016 Jul;33:1-7. doi: 10.1016/j.jnutbio.2015.11.008. Epub 2015 Nov 26.
- Background: PubMed 20669401Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-O-beta-D-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol. 2010 Aug;10(8):959-66. doi: 10.1016/j.intimp.2010.05.009.
- Background: PubMed 30648119Lee B, Moon KM, Kim CY. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J Immunol Res. 2018 Dec 16;2018:2645465. doi: 10.1155/2018/2645465. eCollection 2018.
- Background: PubMed 31394335Ito VC, Lacerda LG. Black rice (Oryza sativa L.): A review of its historical aspects, chemical composition, nutritional and functional properties, and applications and processing technologies. Food Chem. 2019 Dec 15;301:125304. doi: 10.1016/j.foodchem.2019.125304. Epub 2019 Jul 31.
- Background: PubMed 29984532Igwe EO, Charlton KE, Probst YC, Kent K, Netzel ME. A systematic literature review of the effect of anthocyanins on gut microbiota populations. J Hum Nutr Diet. 2019 Feb;32(1):53-62. doi: 10.1111/jhn.12582. Epub 2018 Jul 8.
- Background: PubMed 26712364Hersoug LG, Moller P, Loft S. Gut microbiota-derived lipopolysaccharide uptake and trafficking to adipose tissue: implications for inflammation and obesity. Obes Rev. 2016 Apr;17(4):297-312. doi: 10.1111/obr.12370. Epub 2015 Dec 29.
- Background: PubMed 30263677Bae IY, An JS, Oh IK, Lee HG. Optimized preparation of anthocyanin-rich extract from black rice and its effects on in vitro digestibility. Food Sci Biotechnol. 2017 Aug 28;26(5):1415-1422. doi: 10.1007/s10068-017-0188-x. eCollection 2017.
- Individual participant dataSharing planned: No. Only protocol could be shared for public
Related trials for Obesity
RecruitingObservational study
Endoscopic Sleeve Gastroplasty (ESG) Prospective Trial for Obesity (EGO-Trial)
Obesity
Active, not recruitingPhase 4
Effects of Sequential Therapy With Mexidol® (Intravenous) and Mexidol® FORTE 250 (Oral) on Functional Brain Activity Assessed by Functional Magnetic Resonance Imaging and Biochemical Parameters in Patients With Chronic Cerebral Ischemia: A Comparison of Patients With and Without Metabolic Disorders
Metabolic Abnormalities, Obesity & Overweight
Recruiting
Exercise Training and Vitamin D Metabolism
Obesity & Overweight, Vitamin D
Recruiting
Metabolic Health, Bones and Nuts During Weight Loss in Adults
Weight Loss, Bone Density
Active, not recruiting
Effect of Probiotics on Insulin Sensitivity in Overweight and Obese Pregnancy
Obesity & Overweight, Gestational Diabetes Mellitus (GDM)
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
Agussalim Bukhari, Ph.D principal investigator
Hasanuddin University
Nurpudji Taslim, Prof. principal investigator
Hasanuddin University
Aminuddin Aminuddin, Ph.D principal investigator
Hasanuddin University
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
A study testing Oryza Sativa Extract in people with Obesity, run by Hasanuddin University at 1 site in Indonesia.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 3 inclusion and 4 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: status not confirmed, as of the sponsor's last update on 5 Apr 2021. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in Indonesia. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
Results are not available in the source record.
How can a doctor refer a patient or contact the research team?
Contact Bumi Herman, Ph.D (+66638275008, bumiherman@med.unhas.ac.id), or a site near the patient. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
Lipopolysaccharide (LPS) level of Serum (time frame: Changes of LPS value from baseline to the last day of intervention (three weeks)). The study lists 2 primary outcomes in all. It is what the study was designed to measure, not a finding.
Where can I read the original study information?
On the ClinicalTrials.gov record for NCT04827628, which also lists 11 linked publications.
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 5 Apr 2021.