EpilepsyNCT05269901
Association Between Ferroptosis and Epilepsy
An observational study of Epilepsy, run by Affiliated Hospital of Jiangnan University at 1 site in China.
Trial summary
Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Read more about this study
- Who is it for?
- Ages 6 to 12 yearsHealthy volunteers can take part
- Conditions the study is for
- Epilepsy
- What is being tested?
- SLC7A11, GPX4, P53
- How many people
- 40 participants
- Where
- 1 siteChina
- Study dates
- 20 Jan 2021to 1 Jan 2022
- Phase
- Observational
- Are there results?
- None posted in the registry
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 6 to 12 years
- All sexes
- Healthy volunteers accepted
- Child
Study population: school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022
Who may be able to join
- Aged between 6 and 12 years old
- Newly diagnosed untreated epilepsy
- 1. Aged between 6 and 12 years old
Who cannot join
- Treated with medicine or another therapy
- Had history of cancer diseases
- Had history of endocrine diseases
- Healthy control group
- Had history of epilepsy
- Had history of cancer diseases
- Had history of endocrine diseases
Trial locations and contacts
1 site in 1 country.
China1 site
Affiliated Hospital of JiangNan University, Department of Pediatrics
Wuxi, Jiangsu, 226600
About this study
Official title: Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children
Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
Read the detailed description
To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4）dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11（SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.
- Conditions
- Epilepsy
- Being tested
- SLC7A11, GPX4, P53
- Keywords
- school-aged children, ferroptosis, epilepsy, GPX4
- Medical subject headings
- Epilepsy
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
SLC7A11, GPX4, P53Genetic
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups
| Study group | Role | What they receive |
|---|---|---|
| Seizures group | 20 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics. Receives: Genetic: SLC7A11, GPX4, P53 | |
| Healthy control group | 20 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics. Receives: Genetic: SLC7A11, GPX4, P53 |
What is being measured
The primary outcome is the main question the study is designed to answer.
Rt-qPCR
Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:
GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC
Measured: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.
Secondary outcomes (1)
Western blot
Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53.
Measured: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted8 Mar 2022
- Study start20 Jan 2021
- Primary completion15 Nov 2021
- Study completion1 Jan 2022
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Other trials for EpilepsyStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Case-control
- Time perspective
- Cross-sectional
- Enrolment
- 40 participants (actual)
Sponsor and investigators
- Lead sponsor
- Affiliated Hospital of Jiangnan University
- Sponsor type
- University, hospital or other
- Responsible party
- Sponsor
- Investigators
- YueYing Liu, Study director, Affiliated Hospital of JiangNan University, department of pediatrics
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT05269901
- Sponsor's protocol ID
- 2022/2/21
- Status last verified
- Feb 2022
- First submitted
- 23 Feb 2022
- Last updated
- 15 Apr 2022
- Results posted
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No: Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, we hypothesis GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
Study at a glance
From the registry record, last updated by the sponsor on 15 Apr 2022. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children
- ClinicalTrials.gov ID
- NCT05269901
- Acronym / sponsor ID
- 2022/2/21
- Conditions
- Epilepsy
- Keywords
- school-aged children, ferroptosis, epilepsy, GPX4
- Study type
- Observational
- Recruitment status
- Completed
- Enrolment
- 40 participants (actual)
- Lead sponsor
- Affiliated Hospital of Jiangnan UniversityUniversity, hospital or other
- Study start
- 20 Jan 2021 (actual)
- Primary completion
- 15 Nov 2021 (actual)
- Study completion
- 1 Jan 2022 (actual)
- First posted
- 8 Mar 2022 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
Detailed description
To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4）dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11（SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.
Study design
- Observational model
- Case-control
- Time perspective
- Cross-sectional
- Number of arms
- 2
| Arm | Type | Receives |
|---|---|---|
| Seizures group | – | Genetic: SLC7A11, GPX4, P5320 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics. |
| Healthy control group | – | Genetic: SLC7A11, GPX4, P5320 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics. |
Who may qualify
- Ages
- 6 to 12 years
- Sex
- All
- Healthy volunteers
- Accepted
- Age groups
- Child
- Study population
- school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022
Key inclusion criteria (3 listed)
- Aged between 6 and 12 years old
- Newly diagnosed untreated epilepsy
- 1. Aged between 6 and 12 years old
Key exclusion criteria (7 listed)
- Treated with medicine or another therapy
- Had history of cancer diseases
- Had history of endocrine diseases
- Healthy control group
- Had history of epilepsy
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| SLC7A11, GPX4, P53Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups | Genetic | Healthy control group, Seizures group |
Primary outcome
Rt-qPCR
Time frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.
Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow: GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC
1 secondary outcome
Western blot
Time frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
Results and safety
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 15 Apr 2022.
- Individual participant dataSharing planned: No. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, we hypothesis GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
Related trials for Epilepsy
Recruiting
Identification of Biomarkers for Vagus Nerve Stimulation in Patients With Refractory Epilepsy
Refractory Epilepsy
Recruiting
Mapping of Human Cognition
Epilepsy, Brain Tumor
RecruitingPhase 2/3
A Study to Evaluate the Safety and Efficacy of JZP926 Capsule for the Treatment of Juvenile Myoclonic Epilepsy
Juvenile Myoclonic Epilepsy
RecruitingPhase 3
A Study to Evaluate XEN1101 as Adjunctive Therapy in Primary Generalized Tonic-Clonic Seizures
Primary Generalized Tonic-Clonic Seizures
Recruiting
HOBSCOTCH-YOUTH and Young Adults
Epilepsy, Cognitive Dysfunction, Cognitive Disorder
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
YueYing Liu study director
Affiliated Hospital of JiangNan University, department of pediatrics
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
An observational study of Epilepsy, run by Affiliated Hospital of Jiangnan University at 1 site in China.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 3 inclusion and 7 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: finished, as of the sponsor's last update on 15 Apr 2022. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in China. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
How can a doctor refer a patient or contact the research team?
The record lists no contact. The official record names the sponsor, who can be asked directly. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
Rt-qPCR (time frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 15 Apr 2022.