Gut Microbiota Dysbiosis in Lupus NepheritisNCT06231303
Gut Microbiota Dysbiosis in Lupus Nephritis
An observational study of Gut Microbiota Dysbiosis in Lupus Nepheritis, run by Hager Zanaty.
Trial summary
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls. Read more about this study
- Who is it for?
- Ages 18 to 50 years, women only
- Conditions the study is for
- Gut Microbiota Dysbiosis in Lupus Nepheritis
- What is being tested?
- DNA extraction and PCR amplification
- How many people
- 60 participants
- Where
- No sites listed yet
- Study dates
- Jan 2025to Dec 2026
- Phase
- Observational
- Are there results?
- Not yet: the study is under way
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 50 years
- Women only
- Adult
Study population: Female patients at the of child bearing period
Who may be able to join
- Adult male and female patients diagnosed with lupus nephritis. Adult age and sex matched healthy individuals will be included as a control group.
- Informed consent will be obtained from each study participant.
Who cannot join
- Subjects at age<18 years. Diseases affecting the gut microbiota (e.g. chronic diarrhea, Crohn's disease, or ulcerative colitis).
- Patients on maintenance dialysis, with diabetes or pregnancy, using antibiotics, probiotics, prebiotics, or synbiotics in the previous 4 weeks.
- Patients with critical condition (hypertension emergency,urgency, acute myocardial infarction or stroke within the last 6 months) and suspected/confirmed renal vascular disease.
Trial locations and contacts
No sites are listed yet. Contact the study team or a site near you to ask about taking part.
Rasha Madkour, Lecturer contact
About this study
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Read the detailed description
Systemic Lupus Erythematosus (SLE) is an autoimmune disease resulting in multi-organ inflammation with complex clinical manifestation including neuropsychiatric, lupus nephritis..etc. However, the actual cause of SLE is still unknown [1].
Various etiologies have been postulated which can be categorized into genetic and environmental such as age, gender, ultra-violet exposure, dietary intake, alcohol, and lifestyle behavior [2].
Lupus nephritis is one of the most severe manifestations of SLE with high mortality rate and 10% of them eventually develop end-stage renal disease within 5 years after diagnosis [3,4].
There are trillion of microbes inhabited human gut which dominated by 4 phyla; Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria. In healthy human gut, 98% of gut microbiota is dominated by Bacteroidetes and Firmicutes. Every species of gut microbiota play their own role in modulating immune system. Many factors could alter gut communities such as infant transition, dietary habit, age, gender and antibiotic consumption [5, 6].
Firmicutes responsive in fatty acids and carbohydrates absorption whereas Bacteroidetes correspond to polysaccharides absorption [7].
Recently, enormous reports highlighted on the association of autoimmune diseases with dysbiosis of gut microbiota [8-11], During the autoimmune disease condition, the symbiotic relationship is broken due to various factor such as dietary habit that change microbiota diversity. The decrease of microbial diversity was found in autoimmune diseases such as SLE and inflammatory bowel disease (IBD), presented by reduce commensal bacteria (Firmicutes and Bacteroidetes) and increase of detrimental bacteria (Proteobacteria and Actinobacteria) [12].
Alteration of gut microbiota expresses as Firmicutes/Bacteroidetes ratio (F/B) potentially act as the measurement for pathological condition in SLE patients which cause systemic inflammation. The decreased ratio of F/B microbiome in SLE patients occur either by the reduction in Firmicutes or increase abundance of Bacteroidetes [13]. In human study, altered short chain fatty acids (SCFA) fecal level in lupus patient with low F/B ratio suggest the potential link of gut absorption function with microbes [14].
Hence, it is necessary to identify the exact mechanism on how the gut microbiota promote SLE and LN pathogenesis in human studies.
- Being tested
- DNA extraction and PCR amplification
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
DNA extraction and PCR amplificationGenetic
Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer.
The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows:
Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s.
Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.
| Study group | Role | What they receive |
|---|---|---|
| Patient with lupus nepheritis | Not described Receives: Genetic: DNA extraction and PCR amplification | |
| Healthy persons of the same age | Not described Receives: Genetic: DNA extraction and PCR amplification |
What is being measured
The primary outcome is the main question the study is designed to answer.
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Evaluate the relation of dysbiosis of some intestinal microbiota to the stage of lupus nephritis.
Measured: 2 years
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted30 Jan 2024
- Study startJan 2025 (estimated)
- Primary completionJun 2026 (estimated)
- Study completionDec 2026 (estimated)
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Publications (1)Papers the sponsor has linked to this study.
- Other trials for Gut Microbiota Dysbiosis in Lupus NepheritisStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Cohort
- Time perspective
- Prospective
- Enrolment
- 60 participants (estimated)
Sponsor and investigators
- Lead sponsor
- Hager Zanaty
- Sponsor type
- University, hospital or other
- Responsible party
- Sponsor-investigator, Hager Zanaty, Assiut University
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT06231303
- Sponsor's protocol ID
- Gut microbiota in LN
- Status last verified
- Jan 2024
- First submitted
- 20 Jan 2024
- Last updated
- 30 Jan 2024
- Results posted
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No
Publications
Wang A, Zhao J, Qin Y, Zhang Y, Xing Y, Wang Y, Yu Z, Yan J, Han M, Yuan J, Hui Y, Guo S, Ning X, Sun S. Alterations of the gut microbiota in the lupus nephritis: a systematic review. Ren Fail. 2023;45(2):2285877. doi: 10.1080/0886022X.2023.2285877. Epub 2023 Nov 23.
PubMed 37994423
Study at a glance
From the registry record, last updated by the sponsor on 30 Jan 2024. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Gut Microbiota Dysbiosis in Lupus Nephritis
- ClinicalTrials.gov ID
- NCT06231303
- Acronym / sponsor ID
- Gut microbiota in LN
- Study type
- Observational
- Recruitment status
- Not yet recruiting
- Enrolment
- 60 participants (estimated)
- Lead sponsor
- Hager ZanatyUniversity, hospital or other
- Study start
- Jan 2025 (estimated)
- Primary completion
- Jun 2026 (estimated)
- Study completion
- Dec 2026 (estimated)
- First posted
- 30 Jan 2024 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Detailed description
Systemic Lupus Erythematosus (SLE) is an autoimmune disease resulting in multi-organ inflammation with complex clinical manifestation including neuropsychiatric, lupus nephritis..etc. However, the actual cause of SLE is still unknown [1].
Various etiologies have been postulated which can be categorized into genetic and environmental such as age, gender, ultra-violet exposure, dietary intake, alcohol, and lifestyle behavior [2].
Lupus nephritis is one of the most severe manifestations of SLE with high mortality rate and 10% of them eventually develop end-stage renal disease within 5 years after diagnosis [3,4].
There are trillion of microbes inhabited human gut which dominated by 4 phyla; Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria. In healthy human gut, 98% of gut microbiota is dominated by Bacteroidetes and Firmicutes. Every species of gut microbiota play their own role in modulating immune system. Many factors could alter gut communities such as infant transition, dietary habit, age, gender and antibiotic consumption [5, 6].
Firmicutes responsive in fatty acids and carbohydrates absorption whereas Bacteroidetes correspond to polysaccharides absorption [7].
Recently, enormous reports highlighted on the association of autoimmune diseases with dysbiosis of gut microbiota [8-11], During the autoimmune disease condition, the symbiotic relationship is broken due to various factor such as dietary habit that change microbiota diversity. The decrease of microbial diversity was found in autoimmune diseases such as SLE and inflammatory bowel disease (IBD), presented by reduce commensal bacteria (Firmicutes and Bacteroidetes) and increase of detrimental bacteria (Proteobacteria and Actinobacteria) [12].
Alteration of gut microbiota expresses as Firmicutes/Bacteroidetes ratio (F/B) potentially act as the measurement for pathological condition in SLE patients which cause systemic inflammation. The decreased ratio of F/B microbiome in SLE patients occur either by the reduction in Firmicutes or increase abundance of Bacteroidetes [13]. In human study, altered short chain fatty acids (SCFA) fecal level in lupus patient with low F/B ratio suggest the potential link of gut absorption function with microbes [14].
Hence, it is necessary to identify the exact mechanism on how the gut microbiota promote SLE and LN pathogenesis in human studies.
Study design
- Observational model
- Cohort
- Time perspective
- Prospective
- Number of arms
- 2
| Arm | Type | Receives |
|---|---|---|
| Patient with lupus nepheritis | – | Genetic: DNA extraction and PCR amplification |
| Healthy persons of the same age | – | Genetic: DNA extraction and PCR amplification |
Who may qualify
- Ages
- 18 to 50 years
- Sex
- Female only
- Age groups
- Adult
- Study population
- Female patients at the of child bearing period
Key inclusion criteria (2 listed)
- Adult male and female patients diagnosed with lupus nephritis. Adult age and sex matched healthy individuals will be included as a control group.
- Informed consent will be obtained from each study participant.
Key exclusion criteria (3 listed)
- Subjects at age<18 years. Diseases affecting the gut microbiota (e.g. chronic diarrhea, Crohn's disease, or ulcerative colitis).
- Patients on maintenance dialysis, with diabetes or pregnancy, using antibiotics, probiotics, prebiotics, or synbiotics in the previous 4 weeks.
- Patients with critical condition (hypertension emergency,urgency, acute myocardial infarction or stroke within the last 6 months) and suspected/confirmed renal vascular disease.
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| DNA extraction and PCR amplificationMicrobial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer. The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows: Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s. Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR. | Genetic | Healthy persons of the same age, Patient with lupus nepheritis |
Primary outcome
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Time frame: 2 years
Evaluate the relation of dysbiosis of some intestinal microbiota to the stage of lupus nephritis.
Results and safety
This study is still under way. Results are not available in the source record yet.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 30 Jan 2024.
- Results publication: PubMed 37994423Wang A, Zhao J, Qin Y, Zhang Y, Xing Y, Wang Y, Yu Z, Yan J, Han M, Yuan J, Hui Y, Guo S, Ning X, Sun S. Alterations of the gut microbiota in the lupus nephritis: a systematic review. Ren Fail. 2023;45(2):2285877. doi: 10.1080/0886022X.2023.2285877. Epub 2023 Nov 23.
- Individual participant dataSharing planned: No
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part.
Rasha Madkour, Lecturer contact
Questions about this trial
What is this clinical trial studying?
An observational study of Gut Microbiota Dysbiosis in Lupus Nepheritis, run by Hager Zanaty.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 2 inclusion and 3 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: opening soon, as of the sponsor's last update on 30 Jan 2024. Status can change between updates, so confirm with the study contact before making plans.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
This study is still under way. Results are not available in the source record yet.
How can a doctor refer a patient or contact the research team?
Contact Hager Zanaty (01001228727, hager.znaty.abd@aun.edu.eg), or a site near the patient. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls. (time frame: 2 years). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
On the ClinicalTrials.gov record for NCT06231303, which also lists 1 linked publication.
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 30 Jan 2024; AzTrials last refreshed its copy on 7 Nov 2026.