Black StainsRCTNCT06872827
Effect of Herbal Toothpaste Versus Conventional One on Black Stains
A study testing Herbal toothpaste in people with Black Stains, run by National Research Centre, Egypt at 1 site in Egypt.
Trial summary
Twenty eight children with black stains on their teeth were divided into 2 groups of toothpaste to assess their effect on parental satisfaction, recurrence rate of black stains and change in number of bacteria before and after treatment Read more about this study
- Who is it for?
- Ages 6 to 12 yearsHealthy volunteers can take part
- Conditions the study is for
- Black Stains
- What is being tested?
- Herbal toothpaste
- Could I receive a placebo?
- No, everyone receives an active treatment
- How many people
- 28 participants
- Where
- 1 siteEgypt
- Study dates
- 15 Dec 2024to 1 Mar 2025
- Phase
- Interventional
- Are there results?
- None posted in the registry
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 6 to 12 years
- All sexes
- Healthy volunteers accepted
- Child
Who may be able to join
- Children 6 to 12 years
- Free medical history.
- Presence of black stains covering at least two teeth.
- Good oral hygiene.
Who cannot join
- Children on iron supplements
- Presence of intrinsic stains or fluorosis
- Children using electric toothbrush.
- Children took mouthwash or antibiotic in the last month.
Trial locations and contacts
1 site in 1 country.
About this study
Official title: Effect of Herbal Toothpaste Versus Conventional One on Black Stains in a Group of Egyptian Children: A Randomized Controlled Study
Twenty eight children with black stains on their teeth were divided into 2 groups of toothpaste to assess their effect on parental satisfaction, recurrence rate of black stains and change in number of bacteria before and after treatment
Read the detailed description
TChildren will be enrolled in the study from the outpatient dental Clinic, Medical Centre of Excellence, National Research Centre, Egypt. After professional polishing of blacks stains subjects will be randomly assigned in two groups of equal number (n=28; subdivided to 14 in each group).
The test group will use herbal toothpaste (Dabur Red); (Garik powder (Red ochre), Pippali (Piper longum), Maricha (Piper nigrum), Sunthi (Zingiberofficinale), Tomarbeej (Zanthoxylumarmatum), Karpoor (Cinnamomumcamphora), Laungka Tail (Oil of Syzygiumaromaticum) and Pudinasatva (Menthapiperita).); the control group will use toothpaste with sodiumfluoride toothpaste (Signal). (Aqua, Hydrogenated Starch Hydrolysate, Hydrated Silica, PEG-32, Zinc Citrate, Sodium Lauryl Sulfate, Aroma, MenthaPiperita Oil, Rosmarinus Officinalis Leaf Oil, Cellulose Gum, Sodium Fluoride, Sodium Saccharin, Glycerin, Sodium Bicarbonate, Limonene, CI 74260).
Both test and control groups will use the assigned toothpaste twice a day for 2 months. The study will be double-blinded; sequentially numbered, opaque, sealed envelopes containing the test or the control tooth paste will be prepared.
At the beginning of the study, all subjects will complete a questionnaire including questions regarding socio-demographic variables such as age and sex. Subjects with BS(test and control groups) will also asked about oral hygiene habits such as type of dental brush (manual or electric), dietary habits such as iron supplementation and type of drinking water consumed (tap or mineral water).
The test and control subjects will receive training for home dental hygiene at enrollment and will be contacted by phone every 2 weeks for 2 months to ensure adherence to the protocol and record any recurrence of black stains.
All enrolled subjects will be followed at the Dental Clinic, National Research Centre, Egypt. The study will be consistent with good clinical practices in accordance with the Ethical Principles of the "64th World Medical Association Declaration of Helsinki". All Participants parents will sign a written informed consent before joining the study after brief explanation of all procedures and time table. A verbal assent will be taken from the child before intervention.
Clinical Examination and Samples Collection:
All subjects with BS (both test and control group) will have intraoral examination and professional oral prophylaxis at the enrollment by the same operator. Intraoral photographs will be collected. Clinical evaluation of BS will be assessed carefully to exclude other causes of dental stains. Mean number of Decayed, Missing, and Filled primary and permanent Teeth index (DMFT/deft) will be also calculated.
Salivary Samples collection Five ml of unstimulated saliva samples from all participants from both test and control groups will be collected in a sterile 15 ml falcon tube according to standard procedures. Samples will be collected before using the herbal and conventional toothpaste and after 2 months of their regular use.
DNA extraction Total DNA from the saliva samples of all participants will be done using genomic commercial DNA extraction kit, according to the supplier's instructions. The integrity of DNA will be checked using agarose gel electrophoresis and the concentration and the purity of DNA samples will be checked using NanoDrop spectrophotometer.
Quantification of bacterial species using qRT-PCR Two species of cariogenic bacteria; Streptococcus mutans and Lactobacillus casei are selected to be involved in this study. In addition, two species of chromogenic bacteria; Actinomyces naeslundii and Prevotella melaninogenica will be included in the present study. The sequences of primers of the selected bacterial species; F=TCGCGAAAAAGATAAACAAACA and R=GCCCCTTCACAGTTGGTTAG for (Streptococcus mutans), F=TTAAAGCCATTCTCAGTTCGGA and R=TACGGCTACCTTGTTACGACTT for (Lactobacillus casei) (12). An-F3: CTGCTGCTGACATCGCCGCTCGTA and An-R3: TCCGCTCGCGCCACCTCTCGTTA for (Actinomyces naeslundii), Pm-F3: TGACCGTAAGAAGAAGTTGCCTGTA and Pm-R3: TTGCGACCGATAGCTGCCTTCATA for (Prevotella melaninogenica) (13). Quantification of the selected bacterial species will be carried out using SYBR green master mix, specific primers, DNA and complete the volume of the reaction mixture using sterile RNase and DNase free water. The reaction will be done using real-time polymerase chain reaction in RT-PCR device.
- Conditions
- Black Stains
- Being tested
- Herbal toothpaste
- Keywords
- black stains, bacteria, herbal, child
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
Herbal toothpasteDrug
Also called Dabur Red toothpaste
Intervention
| Study group | Role | What they receive |
|---|---|---|
| Intervention | Experimental | Herbal toothpaste Receives: Drug: Herbal toothpaste |
| Control | Active comparator | Signal toothpaste Receives: Drug: Herbal toothpaste |
What is being measured
The primary outcome is the main question the study is designed to answer.
Parental satisfaction using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
Measured: After 2 months
Secondary outcomes (1)
Recurrence of black stains
Recurrence rate of black stains
Measured: After 2 months
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted12 Mar 2025
- Study start15 Dec 2024
- Primary completion15 Feb 2025
- Study completion1 Mar 2025
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Other trials for Black StainsStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Interventional
- Phase
- Phase N/A
- Primary purpose
- Treatment
- Allocation
- Randomised
- Intervention model
- Parallel groups
- Model description
- Randomized controlled parallel triple blinded study
- Masking
- Triple blind
- Who is masked
- Participant, Care provider, Outcomes assessor
- Enrolment
- 28 participants (actual)
Sponsor and investigators
- Lead sponsor
- National Research Centre, Egypt
- Sponsor type
- University, hospital or other
- Responsible party
- Principal investigator, Mohamed Farouk Rashed, National Research Centre, Egypt
- Investigators
- Mohamed F Rashed, Researcher, Study director, National Research Centre, Egypt
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT06872827
- Sponsor's protocol ID
- 341
- Acronym
- RCT
- Status last verified
- Mar 2025
- First submitted
- 6 Mar 2025
- Last updated
- 12 Mar 2025
- Results posted
- No
- Data monitoring committee
- Yes
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No
Study at a glance
From the registry record, last updated by the sponsor on 12 Mar 2025. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Effect of Herbal Toothpaste Versus Conventional One on Black Stains in a Group of Egyptian Children: A Randomized Controlled Study
- ClinicalTrials.gov ID
- NCT06872827
- Acronym / sponsor ID
- RCT / 341
- Conditions
- Black Stains
- Keywords
- black stains, bacteria, herbal, child
- Study type
- Interventional
- Recruitment status
- Completed
- Enrolment
- 28 participants (actual)
- Lead sponsor
- National Research Centre, EgyptUniversity, hospital or other
- Study start
- 15 Dec 2024 (actual)
- Primary completion
- 15 Feb 2025 (actual)
- Study completion
- 1 Mar 2025 (actual)
- First posted
- 12 Mar 2025 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Twenty eight children with black stains on their teeth were divided into 2 groups of toothpaste to assess their effect on parental satisfaction, recurrence rate of black stains and change in number of bacteria before and after treatment
Detailed description
TChildren will be enrolled in the study from the outpatient dental Clinic, Medical Centre of Excellence, National Research Centre, Egypt. After professional polishing of blacks stains subjects will be randomly assigned in two groups of equal number (n=28; subdivided to 14 in each group).
The test group will use herbal toothpaste (Dabur Red); (Garik powder (Red ochre), Pippali (Piper longum), Maricha (Piper nigrum), Sunthi (Zingiberofficinale), Tomarbeej (Zanthoxylumarmatum), Karpoor (Cinnamomumcamphora), Laungka Tail (Oil of Syzygiumaromaticum) and Pudinasatva (Menthapiperita).); the control group will use toothpaste with sodiumfluoride toothpaste (Signal). (Aqua, Hydrogenated Starch Hydrolysate, Hydrated Silica, PEG-32, Zinc Citrate, Sodium Lauryl Sulfate, Aroma, MenthaPiperita Oil, Rosmarinus Officinalis Leaf Oil, Cellulose Gum, Sodium Fluoride, Sodium Saccharin, Glycerin, Sodium Bicarbonate, Limonene, CI 74260).
Both test and control groups will use the assigned toothpaste twice a day for 2 months. The study will be double-blinded; sequentially numbered, opaque, sealed envelopes containing the test or the control tooth paste will be prepared.
At the beginning of the study, all subjects will complete a questionnaire including questions regarding socio-demographic variables such as age and sex. Subjects with BS(test and control groups) will also asked about oral hygiene habits such as type of dental brush (manual or electric), dietary habits such as iron supplementation and type of drinking water consumed (tap or mineral water).
The test and control subjects will receive training for home dental hygiene at enrollment and will be contacted by phone every 2 weeks for 2 months to ensure adherence to the protocol and record any recurrence of black stains.
All enrolled subjects will be followed at the Dental Clinic, National Research Centre, Egypt. The study will be consistent with good clinical practices in accordance with the Ethical Principles of the "64th World Medical Association Declaration of Helsinki". All Participants parents will sign a written informed consent before joining the study after brief explanation of all procedures and time table. A verbal assent will be taken from the child before intervention.
Clinical Examination and Samples Collection:
All subjects with BS (both test and control group) will have intraoral examination and professional oral prophylaxis at the enrollment by the same operator. Intraoral photographs will be collected. Clinical evaluation of BS will be assessed carefully to exclude other causes of dental stains. Mean number of Decayed, Missing, and Filled primary and permanent Teeth index (DMFT/deft) will be also calculated.
Salivary Samples collection Five ml of unstimulated saliva samples from all participants from both test and control groups will be collected in a sterile 15 ml falcon tube according to standard procedures. Samples will be collected before using the herbal and conventional toothpaste and after 2 months of their regular use.
DNA extraction Total DNA from the saliva samples of all participants will be done using genomic commercial DNA extraction kit, according to the supplier's instructions. The integrity of DNA will be checked using agarose gel electrophoresis and the concentration and the purity of DNA samples will be checked using NanoDrop spectrophotometer.
Quantification of bacterial species using qRT-PCR Two species of cariogenic bacteria; Streptococcus mutans and Lactobacillus casei are selected to be involved in this study. In addition, two species of chromogenic bacteria; Actinomyces naeslundii and Prevotella melaninogenica will be included in the present study. The sequences of primers of the selected bacterial species; F=TCGCGAAAAAGATAAACAAACA and R=GCCCCTTCACAGTTGGTTAG for (Streptococcus mutans), F=TTAAAGCCATTCTCAGTTCGGA and R=TACGGCTACCTTGTTACGACTT for (Lactobacillus casei) (12). An-F3: CTGCTGCTGACATCGCCGCTCGTA and An-R3: TCCGCTCGCGCCACCTCTCGTTA for (Actinomyces naeslundii), Pm-F3: TGACCGTAAGAAGAAGTTGCCTGTA and Pm-R3: TTGCGACCGATAGCTGCCTTCATA for (Prevotella melaninogenica) (13). Quantification of the selected bacterial species will be carried out using SYBR green master mix, specific primers, DNA and complete the volume of the reaction mixture using sterile RNase and DNase free water. The reaction will be done using real-time polymerase chain reaction in RT-PCR device.
Study design
- Primary purpose
- Treatment
- Allocation
- Randomised
- Intervention model
- Parallel groups
- Masking
- Triple blind (participant, care provider, outcomes assessor)
- Number of arms
- 2
- Model description
- Randomized controlled parallel triple blinded study
| Arm | Type | Receives |
|---|---|---|
| Intervention | Experimental | Drug: Herbal toothpasteHerbal toothpaste |
| Control | Active comparator | Drug: Herbal toothpasteSignal toothpaste |
Who may qualify
- Ages
- 6 to 12 years
- Sex
- All
- Healthy volunteers
- Accepted
- Age groups
- Child
Key inclusion criteria (4 listed)
- Children 6 to 12 years
- Free medical history.
- Presence of black stains covering at least two teeth.
- Good oral hygiene.
Key exclusion criteria (4 listed)
- Children on iron supplements
- Presence of intrinsic stains or fluorosis
- Children using electric toothbrush.
- Children took mouthwash or antibiotic in the last month.
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| Herbal toothpasteAlso: Dabur Red toothpasteIntervention | Drug | Control, Intervention |
Primary outcome
Parental satisfaction using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
Time frame: After 2 months
using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
1 secondary outcome
Recurrence of black stains
Time frame: After 2 months
Results and safety
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 12 Mar 2025.
- Individual participant dataSharing planned: No
Related trials for Black Stains
Not yet recruiting
Comparison of Erythritol Air-Polishing and Conventional Polishing Following Ultrasonic Scaling on the Relapse of Chromogenic Tooth Staining in Children
Black Staining
Recruiting
Air Polishers With Erythritol in the Treatment of Dental Black Stain of Bacterial Origin
Black Stain, Black Plaque
Recruiting
A Crossover Clinical Study to Evaluate the Effect of Chitosan Mouthwash on Recurrence of Black Stains in Pediatric Patients
Black Stains
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
Mohamed F Rashed, Researcher study director
National Research Centre, Egypt
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
A study testing Herbal toothpaste in people with Black Stains, run by National Research Centre, Egypt at 1 site in Egypt.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 4 inclusion and 4 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: finished, as of the sponsor's last update on 12 Mar 2025. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in Egypt. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
The study is completed, but results are not available in the source record. That does not mean the treatment did or did not work.
How can a doctor refer a patient or contact the research team?
The record lists no contact. The official record names the sponsor, who can be asked directly. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
Parental satisfaction using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree). (time frame: After 2 months). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 12 Mar 2025.