Intestinal ObstructionNCT05229822
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction
An observational study of Intestinal Obstruction and Colorectal Cancer, run by Karaganda Medical University at 1 site in Kazakhstan.
Trial summary
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. Read more about this study
- Who is it for?
- Ages 18 years and older
- Conditions the study is for
- Intestinal Obstruction, Colorectal Cancer, Post-Op Complication
- What is being tested?
- LBP, sCD14-ST and 16s rRNA
- How many people
- 150 participants
- Where
- 1 siteKazakhstan
- Study dates
- 1 Mar 2021to 31 Dec 2023
- Phase
- Observational
- Are there results?
- Yes, posted in the registrySummary in the doctors' view
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 years and older
- All sexes
- No healthy volunteers
- Adult, Older adult
Study population: Patients with malignant and benign acute bowel obstruction, colorectal cancer patients without acute bowel obstruction (planned operations) aged from 18, who are expected to undergo surgical treatment for this pathology.
Who may be able to join
- patients with malignant acute bowel obstruction,
- patients with benign acute bowel obstruction,
- colorectal cancer patients without acute bowel obstruction (planned operations).
Who cannot join
- age less than 18,
- pregnancy,
- patients with paralytic acute bowel obstruction,
- patients with HIV infection, liver cirrhosis,
- patient with an infectious process due to another pathology.
Trial locations and contacts
1 site in 1 country.
About this study
Official title: Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.
Today there are several methods for detecting BT:
Read more
- direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
- indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.
Read the detailed description
For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.
The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).
During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).
- Conditions
- Intestinal Obstruction, Colorectal Cancer, Post-Op Complication, Systemic Inflammatory Response Syndrome, Colon Tumor
- Being tested
- LBP, sCD14-ST, 16s rRNA
- Keywords
- acute bowel obstruction, colon tumor, bacterial translocation, presepsin, lipopolysaccharide-binding protein, 16s rRNA, post-operative complications
- Medical subject headings
- Intestinal Obstruction, Colorectal Neoplasms, Postoperative Complications, Systemic Inflammatory Response Syndrome, Colonic Neoplasms
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
LBPDiagnostic test
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
sCD14-STDiagnostic test
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
16s rRNADiagnostic test
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.
| Study group | Role | What they receive |
|---|---|---|
| Malignant ABO | 60 patients with malignant acute bowel obstruction Receives: Diagnostic Test: LBP; Diagnostic Test: sCD14-ST; Diagnostic Test: 16s rRNA | |
| CRC without ABO (control) | 60 colorectal cancer patients without acute bowel obstruction (planned operations) Receives: Diagnostic Test: LBP; Diagnostic Test: sCD14-ST; Diagnostic Test: 16s rRNA | |
| Benign ABO | 30 patients with benign acute bowel obstruction Receives: Diagnostic Test: LBP; Diagnostic Test: sCD14-ST; Diagnostic Test: 16s rRNA |
What is being measured
The primary outcome is the main question the study is designed to answer.
Change in Number of Participants With Post-operative Infectious and Inflammatory Complications
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
Measured: Once (if any complication occurs during hospitalization - from 7 to 28 days)
Secondary outcomes (3)
LBP Level in Serum Blood
LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Measured: 1 hour before surgery, 72 hours after surgery
sCD14-ST Level in Serum Blood
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Measured: 1 hour before surgery, 72 hours after surgery
16s rRNA in Mesenteric Lymph Nodes
Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.
Measured: Once (MLN sampling in sterile conditions during surgery)
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted8 Feb 2022
- Study start1 Mar 2021
- Primary completion31 Oct 2023
- Study completion31 Dec 2023
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Posted resultsParticipant flow, outcome measures and adverse events reported by the sponsor.
- Publications (19)Papers the sponsor has linked to this study.
- Other trials for Intestinal ObstructionStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Other
- Time perspective
- Prospective
- Enrolment
- 150 participants (actual)
Sponsor and investigators
- Lead sponsor
- Karaganda Medical University
- Sponsor type
- University, hospital or other
- Collaborators
- Ministry of Education and Science, Republic of Kazakhstan
- Responsible party
- Sponsor
- Investigators
- Yemek Turgunov, Pr., Study chair, NJSC Karaganda Medical UniversityAlina Ogizbayeva, PhD student, Principal investigator, NJSC Karaganda Medical UniversityLyudmila Akhmaltdinova, PhD, Principal investigator, NJSC Karaganda Medical UniversityKairat Shakeyev, Pr., Principal investigator, NJSC Karaganda Medical UniversityDmitry Matyushko, PhD, Principal investigator, Multidisciplinary hospital No. 1 of KaragandaMiras Mugazov, PhD, Principal investigator, NJSC Karaganda Medical UniversityAsylbek Zhumakaev, Master, Principal investigator, Multidisciplinary hospital No. 3 of KaragandaIrina Kadyrova, PhD, Principal investigator, NJSC Karaganda Medical University
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT05229822
- Sponsor's protocol ID
- BT-ABO
- Status last verified
- Nov 2024
- First submitted
- 21 Jan 2022
- Last updated
- 16 Jan 2025
- Results posted
- Yes, on ClinicalTrials.gov
- Data monitoring committee
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
- Individual data sharing
- No
Publications
Gore RM, Silvers RI, Thakrar KH, Wenzke DR, Mehta UK, Newmark GM, Berlin JW. Bowel Obstruction. Radiol Clin North Am. 2015 Nov;53(6):1225-40. doi: 10.1016/j.rcl.2015.06.008.
PubMed 26526435Taylor MR, Lalani N. Adult small bowel obstruction. Acad Emerg Med. 2013 Jun;20(6):528-44. doi: 10.1111/acem.12150.
PubMed 23758299Roses RE, Folkert IW, Krouse RS. Malignant Bowel Obstruction: Reappraising the Value of Surgery. Surg Oncol Clin N Am. 2018 Oct;27(4):705-715. doi: 10.1016/j.soc.2018.05.010. Epub 2018 Jul 21.
PubMed 30213414Shwaartz C, Fields AC, Prigoff JG, Aalberg JJ, Divino CM. Should patients With obstructing colorectal cancer have proximal diversion? Am J Surg. 2017 Apr;213(4):742-747. doi: 10.1016/j.amjsurg.2016.08.005. Epub 2016 Sep 2.
PubMed 27742029Chiu HC, Lin YC, Hsieh HM, Chen HP, Wang HL, Wang JY. The impact of complications on prolonged length of hospital stay after resection in colorectal cancer: A retrospective study of Taiwanese patients. J Int Med Res. 2017 Apr;45(2):691-705. doi: 10.1177/0300060516684087. Epub 2017 Feb 7.
PubMed 28173723Simillis C, Kalakouti E, Afxentiou T, Kontovounisios C, Smith JJ, Cunningham D, Adamina M, Tekkis PP. Primary Tumor Resection in Patients with Incurable Localized or Metastatic Colorectal Cancer: A Systematic Review and Meta-analysis. World J Surg. 2019 Jul;43(7):1829-1840. doi: 10.1007/s00268-019-04984-2.
PubMed 30903246Wancata LM, Abdelsattar ZM, Suwanabol PA, Campbell DA Jr, Hendren S. Outcomes After Surgery for Benign and Malignant Small Bowel Obstruction. J Gastrointest Surg. 2017 Feb;21(2):363-371. doi: 10.1007/s11605-016-3307-8. Epub 2016 Oct 25.
PubMed 27783343Stubljar D, Skvarc M. Effective Strategies for Diagnosis of Systemic Inflammatory Response Syndrome (SIRS) due to Bacterial Infection in Surgical Patients. Infect Disord Drug Targets. 2015;15(1):53-6. doi: 10.2174/1871526515666150320161804.
PubMed 25809624Levy M, Kolodziejczyk AA, Thaiss CA, Elinav E. Dysbiosis and the immune system. Nat Rev Immunol. 2017 Apr;17(4):219-232. doi: 10.1038/nri.2017.7. Epub 2017 Mar 6.
PubMed 28260787Piton G, Capellier G. Biomarkers of gut barrier failure in the ICU. Curr Opin Crit Care. 2016 Apr;22(2):152-60. doi: 10.1097/MCC.0000000000000283.
PubMed 26808138Tsujimoto H, Ono S, Mochizuki H. Role of translocation of pathogen-associated molecular patterns in sepsis. Dig Surg. 2009;26(2):100-9. doi: 10.1159/000206143. Epub 2009 Mar 2.
PubMed 19252406MacFie J, Reddy BS, Gatt M, Jain PK, Sowdi R, Mitchell CJ. Bacterial translocation studied in 927 patients over 13 years. Br J Surg. 2006 Jan;93(1):87-93. doi: 10.1002/bjs.5184.
PubMed 16288452Fang L, Xu Z, Wang GS, Ji FY, Mei CX, Liu J, Wu GM. Directed evolution of an LBP/CD14 inhibitory peptide and its anti-endotoxin activity. PLoS One. 2014 Jul 15;9(7):e101406. doi: 10.1371/journal.pone.0101406. eCollection 2014.
PubMed 25025695Stehle JR Jr, Leng X, Kitzman DW, Nicklas BJ, Kritchevsky SB, High KP. Lipopolysaccharide-binding protein, a surrogate marker of microbial translocation, is associated with physical function in healthy older adults. J Gerontol A Biol Sci Med Sci. 2012 Nov;67(11):1212-8. doi: 10.1093/gerona/gls178. Epub 2012 Sep 7.
PubMed 22960476Kell DB, Pretorius E. On the translocation of bacteria and their lipopolysaccharides between blood and peripheral locations in chronic, inflammatory diseases: the central roles of LPS and LPS-induced cell death. Integr Biol (Camb). 2015 Nov;7(11):1339-77. doi: 10.1039/c5ib00158g.
PubMed 26345428
Study at a glance
From the registry record, last updated by the sponsor on 16 Jan 2025. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction
- ClinicalTrials.gov ID
- NCT05229822
- Acronym / sponsor ID
- BT-ABO
- Conditions
- Intestinal Obstruction, Colorectal Cancer, Post-Op Complication, Systemic Inflammatory Response Syndrome, Colon Tumor
- Keywords
- acute bowel obstruction, colon tumor, bacterial translocation, presepsin, lipopolysaccharide-binding protein, 16s rRNA, post-operative complications
- Study type
- Observational
- Recruitment status
- Completed
- Enrolment
- 150 participants (actual)
- Lead sponsor
- Karaganda Medical UniversityUniversity, hospital or other
- Collaborators
- Ministry of Education and Science, Republic of Kazakhstan
- Study start
- 1 Mar 2021 (actual)
- Primary completion
- 31 Oct 2023 (actual)
- Study completion
- 31 Dec 2023 (actual)
- First posted
- 8 Feb 2022 (actual)
- Results
- Posted 16 Jan 2025
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.
Today there are several methods for detecting BT:
- direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
- indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.
Detailed description
For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.
The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).
During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).
Study design
- Observational model
- Other
- Time perspective
- Prospective
- Number of arms
- 3
| Arm | Type | Receives |
|---|---|---|
| Malignant ABO | – | Diagnostic Test: LBP, Diagnostic Test: sCD14-ST, Diagnostic Test: 16s rRNA60 patients with malignant acute bowel obstruction |
| CRC without ABO (control) | – | Diagnostic Test: LBP, Diagnostic Test: sCD14-ST, Diagnostic Test: 16s rRNA60 colorectal cancer patients without acute bowel obstruction (planned operations) |
| Benign ABO | – | Diagnostic Test: LBP, Diagnostic Test: sCD14-ST, Diagnostic Test: 16s rRNA30 patients with benign acute bowel obstruction |
Who may qualify
- Ages
- 18 years and older
- Sex
- All
- Healthy volunteers
- Not accepted
- Age groups
- Adult, Older adult
- Study population
- Patients with malignant and benign acute bowel obstruction, colorectal cancer patients without acute bowel obstruction (planned operations) aged from 18, who are expected to undergo surgical treatment for this pathology.
Key inclusion criteria (3 listed)
- patients with malignant acute bowel obstruction,
- patients with benign acute bowel obstruction,
- colorectal cancer patients without acute bowel obstruction (planned operations).
Key exclusion criteria (5 listed)
- age less than 18,
- pregnancy,
- patients with paralytic acute bowel obstruction,
- patients with HIV infection, liver cirrhosis,
- patient with an infectious process due to another pathology.
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| LBPDetermine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. | Diagnostic test | Benign ABO, CRC without ABO (control), Malignant ABO |
| sCD14-STDetermine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. | Diagnostic test | Benign ABO, CRC without ABO (control), Malignant ABO |
| 16s rRNADetermine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. | Diagnostic test | Benign ABO, CRC without ABO (control), Malignant ABO |
Primary outcome
Change in Number of Participants With Post-operative Infectious and Inflammatory Complications
Time frame: Once (if any complication occurs during hospitalization - from 7 to 28 days)
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
3 secondary outcomes
LBP Level in Serum Blood
Time frame: 1 hour before surgery, 72 hours after surgery
sCD14-ST Level in Serum Blood
Time frame: 1 hour before surgery, 72 hours after surgery
16s rRNA in Mesenteric Lymph Nodes
Time frame: Once (MLN sampling in sterile conditions during surgery)
Results and safety
Loading the posted results from ClinicalTrials.gov…
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 16 Jan 2025.
- Posted resultsParticipant flow, baseline, all outcome measures and adverse events.
- Background: PubMed 26526435Gore RM, Silvers RI, Thakrar KH, Wenzke DR, Mehta UK, Newmark GM, Berlin JW. Bowel Obstruction. Radiol Clin North Am. 2015 Nov;53(6):1225-40. doi: 10.1016/j.rcl.2015.06.008.
- Background: PubMed 23758299Taylor MR, Lalani N. Adult small bowel obstruction. Acad Emerg Med. 2013 Jun;20(6):528-44. doi: 10.1111/acem.12150.
- Background: PubMed 30213414Roses RE, Folkert IW, Krouse RS. Malignant Bowel Obstruction: Reappraising the Value of Surgery. Surg Oncol Clin N Am. 2018 Oct;27(4):705-715. doi: 10.1016/j.soc.2018.05.010. Epub 2018 Jul 21.
- Background: PubMed 27742029Shwaartz C, Fields AC, Prigoff JG, Aalberg JJ, Divino CM. Should patients With obstructing colorectal cancer have proximal diversion? Am J Surg. 2017 Apr;213(4):742-747. doi: 10.1016/j.amjsurg.2016.08.005. Epub 2016 Sep 2.
- Background: PubMed 28173723Chiu HC, Lin YC, Hsieh HM, Chen HP, Wang HL, Wang JY. The impact of complications on prolonged length of hospital stay after resection in colorectal cancer: A retrospective study of Taiwanese patients. J Int Med Res. 2017 Apr;45(2):691-705. doi: 10.1177/0300060516684087. Epub 2017 Feb 7.
- Background: PubMed 30903246Simillis C, Kalakouti E, Afxentiou T, Kontovounisios C, Smith JJ, Cunningham D, Adamina M, Tekkis PP. Primary Tumor Resection in Patients with Incurable Localized or Metastatic Colorectal Cancer: A Systematic Review and Meta-analysis. World J Surg. 2019 Jul;43(7):1829-1840. doi: 10.1007/s00268-019-04984-2.
- Background: PubMed 27783343Wancata LM, Abdelsattar ZM, Suwanabol PA, Campbell DA Jr, Hendren S. Outcomes After Surgery for Benign and Malignant Small Bowel Obstruction. J Gastrointest Surg. 2017 Feb;21(2):363-371. doi: 10.1007/s11605-016-3307-8. Epub 2016 Oct 25.
- Background: PubMed 25809624Stubljar D, Skvarc M. Effective Strategies for Diagnosis of Systemic Inflammatory Response Syndrome (SIRS) due to Bacterial Infection in Surgical Patients. Infect Disord Drug Targets. 2015;15(1):53-6. doi: 10.2174/1871526515666150320161804.
- Background: PubMed 28260787Levy M, Kolodziejczyk AA, Thaiss CA, Elinav E. Dysbiosis and the immune system. Nat Rev Immunol. 2017 Apr;17(4):219-232. doi: 10.1038/nri.2017.7. Epub 2017 Mar 6.
- Background: PubMed 26808138Piton G, Capellier G. Biomarkers of gut barrier failure in the ICU. Curr Opin Crit Care. 2016 Apr;22(2):152-60. doi: 10.1097/MCC.0000000000000283.
- Background: PubMed 19252406Tsujimoto H, Ono S, Mochizuki H. Role of translocation of pathogen-associated molecular patterns in sepsis. Dig Surg. 2009;26(2):100-9. doi: 10.1159/000206143. Epub 2009 Mar 2.
- Background: PubMed 16288452MacFie J, Reddy BS, Gatt M, Jain PK, Sowdi R, Mitchell CJ. Bacterial translocation studied in 927 patients over 13 years. Br J Surg. 2006 Jan;93(1):87-93. doi: 10.1002/bjs.5184.
- Mierzchala M, Krzystek-Korpacka M, Gamian A, Durek G. Quantitative indices of dynamics in concentrations of lipopolysaccharide-binding protein (LBP) as prognostic factors in severe sepsis/septic shock patients - Comparison with CRP and procalcitonin /Link provided by the sponsor.
- Masson S, Caironi P, Fanizza C, Thomae R, Bernasconi R, Noto A, Oggioni R, Pasetti GS, Romero M, Tognoni G, Latini R, Gattinoni L. Circulating presepsin (soluble CD14 subtype) as a marker of host response in patients with severe sepsis or septic shockLink provided by the sponsor.
- Individual participant dataSharing planned: No
Related trials for Intestinal Obstruction
Not yet recruitingPhase 2
SAMe in Prevention of Oxaliplatin-associated Liver Injury
Colorectal Cancer, Liver Metastases
Active, not recruiting
Compassionate-Use of 4% T-EDTA Lock Solution for Central Venous Lines of Pediatric PN Patients
Central Line Complication, Central Line-associated Bloodstream Infection (CLABSI)
Enrolling by invitationObservational study
Intestinal Obstruction Surgery. Acute Abdominal Pathology. №9:05/05/2026
Small Bowel Adhesion, Obstruction Bowel
Recruiting
Rectus Sheath Catheters Following Midline Laparotomy
Acute Abdomen, Ileus
RecruitingObservational study
Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
Rare Disorders, Undiagnosed Disorders
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part. This study is not recruiting at the moment.
Yemek Turgunov, Pr. study chair
NJSC Karaganda Medical University
Alina Ogizbayeva, PhD student principal investigator
NJSC Karaganda Medical University
Lyudmila Akhmaltdinova, PhD principal investigator
NJSC Karaganda Medical University
1 site in 1 country: see every site and its status.
Questions about this trial
What is this clinical trial studying?
An observational study of Intestinal Obstruction and Colorectal Cancer, run by Karaganda Medical University at 1 site in Kazakhstan.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 3 inclusion and 5 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: finished, as of the sponsor's last update on 16 Jan 2025. Status can change between updates, so confirm with the study contact before making plans.
Where is the study taking place?
The record lists 1 site in Kazakhstan. Whether a site is taking part right now should be confirmed with that site. See every site.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
Yes. Results are posted in the registry (first posted 16 Jan 2025). A summary is in the For doctors view, and the full results are on ClinicalTrials.gov.
How can a doctor refer a patient or contact the research team?
The record lists no contact. The official record names the sponsor, who can be asked directly. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
Change in Number of Participants With Post-operative Infectious and Inflammatory Complications (time frame: Once (if any complication occurs during hospitalization - from 7 to 28 days)). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
On the ClinicalTrials.gov record for NCT05229822, which also lists 19 linked publications.
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 16 Jan 2025.