Rhematoid ArthritisNCT07397741
Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis
An observational study of Rhematoid Arthritis, run by Sohag University.
Trial summary
Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs. The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to… Read more about this study
- Who is it for?
- Ages 18 to 60 yearsHealthy volunteers can take part
- Conditions the study is for
- Rhematoid Arthritis
- What is being tested?
- Gene expression by quantitative Real Time PCR
- How many people
- 60 participants
- Where
- No sites listed yet
- Study dates
- 1 Mar 2026to 1 Mar 2027
- Phase
- Observational
- Are there results?
- Not yet: the study is under way
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 60 years
- All sexes
- Healthy volunteers accepted
- Adult
Study population: Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex
Who may be able to join
- Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.
Who cannot join
- • Patients with co-existing infections or other autoimmune diseases.
Trial locations and contacts
No sites are listed yet. Contact the study team or a site near you to ask about taking part.
About this study
Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs.
The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.
Read the detailed description
Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease.
Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage.
The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research.
The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation.
CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18.
Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17.
The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.
- Conditions
- Rhematoid Arthritis
- Being tested
- Gene expression by quantitative Real Time PCR
- Keywords
- CCR6/CCL20 axis in Rheumatoid arthritis
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
Gene expression by quantitative Real Time PCRGenetic
Sample collection:
- 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay
- Total RNA Extraction
- cDNA Synthesis
- Gene Expression Analysis:
- Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC
- Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level
- Using Enzyme Linked Immunosorbent Assay kit (ELISA).
| Study group | Role | What they receive |
|---|---|---|
| Group I | Patients with Rheumatoid Arthritis Receives: Genetic: Gene expression by quantitative Real Time PCR | |
| Group II | apparently healthy controls with no chronic illness of matched age and sex Receives: Genetic: Gene expression by quantitative Real Time PCR |
What is being measured
The primary outcome is the main question the study is designed to answer.
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals
assessment of CCR6 gene expression level using quantitative real time PCR
Measured: within 3 days of samples collection
Secondary outcomes (1)
Measure the plasma levels of CCL20
Measurement of the plasma levels of CCL20 using enzyme-linked immunosorbent assay (ELISA)
Measured: within 3 days after samples collection
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted9 Feb 2026
- Study start1 Mar 2026 (estimated)
- Primary completion1 Feb 2027 (estimated)
- Study completion1 Mar 2027 (estimated)
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Publications (3)Papers the sponsor has linked to this study.
- Other trials for Rhematoid ArthritisStudies of the same condition, open and under way.
- More trials run by Sohag UniversityThe sponsor's other registered studies.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Case-control
- Time perspective
- Cross-sectional
- Enrolment
- 60 participants (estimated)
Sponsor and investigators
- Lead sponsor
- Sohag University
- Sponsor type
- University, hospital or other
- Responsible party
- Principal investigator, Salma Khalaf Abdelmageed, Sohag University
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT07397741
- Sponsor's protocol ID
- Soh-Med-26-1-3MD
- Status last verified
- Feb 2026
- First submitted
- 30 Jan 2026
- Last updated
- 9 Feb 2026
- Results posted
- No
- Data monitoring committee
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
Publications
Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R, Cipriani P. Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev. 2021 Feb;20(2):102735. doi: 10.1016/j.autrev.2020.102735. Epub 2020 Dec 17.
PubMed 33346115Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Birchmeier C, Wagner EF, Murphy KM, Myers RM, Bonneau R, Littman DR. A validated regulatory network for Th17 cell specification. Cell. 2012 Oct 12;151(2):289-303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25.
PubMed 230217771- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.
Study at a glance
From the registry record, last updated by the sponsor on 9 Feb 2026. Recruitment status is as the sponsor reported it: confirm with the study team.
- Official title
- Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis
- ClinicalTrials.gov ID
- NCT07397741
- Acronym / sponsor ID
- Soh-Med-26-1-3MD
- Conditions
- Rhematoid Arthritis
- Keywords
- CCR6/CCL20 axis in Rheumatoid arthritis
- Study type
- Observational
- Recruitment status
- Not yet recruiting
- Enrolment
- 60 participants (estimated)
- Lead sponsor
- Sohag UniversityUniversity, hospital or other
- Study start
- 1 Mar 2026 (estimated)
- Primary completion
- 1 Feb 2027 (estimated)
- Study completion
- 1 Mar 2027 (estimated)
- First posted
- 9 Feb 2026 (actual)
- Results
- Not posted in the source record
Clinical summary
The research question as the sponsor registered it. This describes what the study plans to test, not what it found.
Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs.
The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.
Detailed description
Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease.
Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage.
The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research.
The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation.
CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18.
Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17.
The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.
Study design
- Observational model
- Case-control
- Time perspective
- Cross-sectional
- Number of arms
- 2
| Arm | Type | Receives |
|---|---|---|
| Group I | – | Genetic: Gene expression by quantitative Real Time PCRPatients with Rheumatoid Arthritis |
| Group II | – | Genetic: Gene expression by quantitative Real Time PCRapparently healthy controls with no chronic illness of matched age and sex |
Who may qualify
- Ages
- 18 to 60 years
- Sex
- All
- Healthy volunteers
- Accepted
- Age groups
- Adult
- Study population
- Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex
Key inclusion criteria (1 listed)
- Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.
Key exclusion criteria (1 listed)
- • Patients with co-existing infections or other autoimmune diseases.
Eligibility is decided by the study team after screening; this overview does not establish that a patient qualifies. Full inclusion and exclusion criteria.
Interventions
| Intervention | Type | Arms |
|---|---|---|
| Gene expression by quantitative Real Time PCRSample collection: * 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay * Total RNA Extraction * cDNA Synthesis * Gene Expression Analysis: o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC * Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level * Using Enzyme Linked Immunosorbent Assay kit (ELISA). | Genetic | Group I, Group II |
Primary outcome
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals
Time frame: within 3 days of samples collection
assessment of CCR6 gene expression level using quantitative real time PCR
1 secondary outcome
Measure the plasma levels of CCL20
Time frame: within 3 days after samples collection
Results and safety
This study is still under way. Results are not available in the source record yet.
Research links
- Official record on ClinicalTrials.govLast updated by the sponsor 9 Feb 2026.
- Background: PubMed 33346115Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R, Cipriani P. Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev. 2021 Feb;20(2):102735. doi: 10.1016/j.autrev.2020.102735. Epub 2020 Dec 17.
- Background: PubMed 23021777Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Birchmeier C, Wagner EF, Murphy KM, Myers RM, Bonneau R, Littman DR. A validated regulatory network for Th17 cell specification. Cell. 2012 Oct 12;151(2):289-303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25.
- Background1- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.
Related trials for Rhematoid Arthritis
Enrolling by invitationObservational study
Persona SoluTion PPS Femur PMCF
Rhematoid Arthritis, Osteo Arthritis of the Knee
RecruitingObservational study
Tornier Perform™ Reversed Monopost Study
Non-inflammatory Degenerative Joint Disease, Rhematoid Arthritis
RecruitingPhase 1
A Phase 1 Study of JADE201 in Participants With Rheumatoid Arthritis
Rhematoid Arthritis
Not yet recruiting
Wrist Nerve Block as a New Treatment in Patients With Rheumatoid Arthritis
Rhematoid Arthritis
Not yet recruitingObservational study
Kinesiophobia in Rheumatoid Arthritis: Associations With Functional Disability, Disease Activity, and Related Clinical Factors
Kinesiophobia (Fear of Movement), Rhematoid Arthritis
Referral and contact
AzTrials does not enrol participants or take referrals. Contact the study team or a site listed below; they decide who can take part.
Questions about this trial
What is this clinical trial studying?
An observational study of Rhematoid Arthritis, run by Sohag University.
The full registered description is in the About this study section and the official record.
Who may be eligible to take part?
The sponsor lists 1 inclusion and 1 exclusion criteria. Eligibility is decided by the study team after screening, so read the full criteria and contact a listed site.
Is this clinical trial currently recruiting?
The record says: opening soon, as of the sponsor's last update on 9 Feb 2026. Status can change between updates, so confirm with the study contact before making plans.
What are the possible benefits and risks?
They depend on the study and the treatment, and no study can promise a benefit. The study team explains the known risks during informed consent, before anyone joins; the record itself does not list them.
Are results available for this study?
This study is still under way. Results are not available in the source record yet.
How can a doctor refer a patient or contact the research team?
Contact Salma Khalaf Abdelmageed, Assistant Lecturer (01091285241, salma011101@med.sohag.edu.eg), or a site near the patient. AzTrials does not enrol participants or take referrals.
What does the primary outcome measure?
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals (time frame: within 3 days of samples collection). It is what the study was designed to measure, not a finding.
Where can I read the original study information?
On the ClinicalTrials.gov record for NCT07397741, which also lists 3 linked publications.
Does a listing mean the treatment is approved or proven to work?
No. A listing means the study is registered. It does not show that the treatment is safe, works, or is approved by a regulator.
How often is this information updated?
AzTrials copies changed records from ClinicalTrials.gov every night and reloads the whole registry every week. The sponsor last updated this record on 9 Feb 2026.